Ophidiens, sauriens, amphibiens
Vous aimez Café-terra? Dites-le sur Facebook, cliquez sur


Partagez | 

 La génétique "pour les nuls" 1ère partie

Aller en bas 

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 12:14

Depuis quelques temps déjà, j'observe avec plaisir des amis du forums qui aimeraient comprendre la génétique, mais qui trouvent les discours de ceux qui maîtrisent le sujet (en ce qui me concerne, c'est quand même bien loin d'être le cas) assez compliqués, voir ennuyeux...

Et si on abordait "la chose" avec simplicité?

Jacques, qui aime comprendre et que les autres comprenne, a offert à David des petits bouquins illustrés afin de l'amener à se pencher sur le sujet, et à en comprendre les bases.

Vilaine curieuse que je suis, je n'ai pas pu m'empêcher d'aller y fourrer mon nez, et j'ai bien envie de m'en inspirer pour tenter de convertir les récalcitrants à cette "science" particulièrement intéressante, que ce soit pour notre passion, ou pour notre simple culture générale Wink


Quel est cet animal? Je vois venir les petits malins, non, ce n'est pas un singe, on n'est pas là pour faire de l'humour, c'est une affaire sérieuse la génétique!

Une tête, un thorax, un nombril, des genoux, des orteils... gagné! C'est un humain (quoi que vous en pensiez Laughing )

Et maintenant? Encore des humains! Oui mais regardez-les bien: aucun ne se ressemble, ils sont tous différents, bien qu'ils soient (presque) tous reconnaissable en tant qu'être humain!

Et là, que voyez-vous? Encore gagné, le doute n'est pas permis, ce sont bien des vaches! Mais là encore, observez-les plus attentivement, elles sont toutes différentes. Comme les humains, elles sont clairement identifiables comme appartenant à la même espèce, mais chacune d'entre elles est unique!

En un mot, chaque espèce est identifiable car les individus qui la composent ont des caractéristiques communes, mais aucun n'est identique à l'autre au sein d'une même espèce: tous pareils et tous différents. Pourtant, à l'époque où tous ces individus n'étaient qu'une seule cellule oeuf, seuls des spécialistes auraient pu les différencier les unes des autres. Néanmoins, toutes ces cellules oeuf à priori identiques sont d'ores et déjà programmées pour donner des individus différents au sein d'une même espèce, tout ça grâce au génome.

Ah ah ah, j'en vois déjà deux ou trois se crisper, ça y est, fini la rigolade, elle nous sort les grands mots affraid

Détendez-vous, respirez un bon coup, on y va!

C'est dans les gènes de chaque individu que sont inscrites les caractéristiques propres à son espèce (homme, vache, cochon, mouche, etc...), mais aussi toutes les caractéristiques qui font de cet individu un être unique et différents des autres.

Jusque dans les années 1860, on n'avait qu'une vague idée de ce qu'était l'hérédité. C'est en ce temps là qu'un dénommé Gregor Mendel, moine de son état, se mit en tête de comprendre comment les caractéristiques d'un être vivant se transmettait d'une génération à l'autre (pour avoir une idée pareille à cette époque, ce type là ne devait pas être tout seul dans sa tête... peut-être un lointain ancêtre de quelqu'un que nous fréquentons tous sur ce forum... enfin bref, revenons à nos moutons... ou à nos vaches! lol! ). Le dit Mendel, donc, se mit à cultiver des petits pois (avec d'autres idées en tête que d'en faire un bon souper... Chris, sors de ce corps...).

En quelques années, il sema, arrosa, récolta, écossa, tria, compta et recompta des milliers de petits pois (il devait pas avoir grand chose à faire dans la vie, ce garçon), c'est ainsi que germa dans son crâne une grande théorie sur l'hérédité des caractéristiques d'une être vivant (me rappelle décidément quelqu'un, ce gars-là).

Il observa tout d'abord qu'en croisant deux sortes de petits poids, des jaunes et des verts (fallait y penser!) il n'obtenait systématiquement que des jaunes (qui l'eût cru?!). Et en recroisant ces pois jaunes entre eux, il retrouvait (ça alors!!!) des pois verts! Et à tous les coups, il obtenait en moyenne 1/4 de pois verts pour 3/4 de pois jaunes... étonnant non???

C'est alors qu'il élabora une première théorie sur la génétique:
Chaque caractéristique d'un être vivant (en l'occurrence, petit pois...) est gouvernée par deux "facteurs". Si on les mélange, un seul peut s'exprimer, il est donc plus "fort" que l'autre, il est dominant. Il vérifia cette théorie sur plusieurs autres caractéristiques du petit pois, et montra à l'humanité toute entière que les différents caractères sont indépendants les uns des autres, tout comme les "facteurs" qui les contrôlent.

Il publia sa découverte dans une sombre gazette locale qui tomba dans l'oubli, l'humanité toute entière n'eut pas connaissance de sa géniale théorie, il avait pas d'bol

Mais la science n'en continua pas moins d'avancer. Par un beau jour de 1879, un dénommé Flemming tomba nez à nez avec des chromosomes, mais ne sut pas qu'en foutre...

En 1900, trois savants dont les noms ne vous intéressent sans doute pas davantage que la couleur des petits pois de Mendel, firent chacun dans leur coin une découverte fascinante: la même que notre bon vieux Gregor avec son invraissemblable potager! Pour ne pas se chamailler, ils appelèrent leur trouvaille "les lois de Mendel", et c'est ainsi que le génie de notre moine cultivateur fut enfin reconnu Laughing

C'est en 1909 qu'un dénommé Johannsen inventa le mot gène pour désigner les "facteurs" de Mendel, et le mot génétique qui va avec.

La suite plus tard ---->

Dernière édition par Cheyenne le Ven 12 Mar - 14:57, édité 3 fois
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com
Tombeur de ces dames
Tombeur de ces dames

Messages : 1356
Date d'inscription : 18/03/2009
Age : 41
Localisation : 26

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 12:18

merde moi et la génétique ca fait 15 Laughing
je croyais que sur la première photo c'était un grand cerf
Revenir en haut Aller en bas
Voir le profil de l'utilisateur

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 12:19

J'ai dit que c'était une affaire sérieuse!!! lol!
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com
Tombeur de ces dames
Tombeur de ces dames

Messages : 1356
Date d'inscription : 18/03/2009
Age : 41
Localisation : 26

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 12:25

désolé j'ai pas pu me retenir lol!
Revenir en haut Aller en bas
Voir le profil de l'utilisateur

Messages : 638
Date d'inscription : 21/03/2009

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 12:26

la troisieme photo ? ce sont des membres du forum ?

Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Café royal
Café royal

Messages : 2755
Date d'inscription : 19/03/2009
Age : 42
Localisation : meyzieu banlieu lyon

MessageSujet: .   Ven 12 Mar - 12:26

cheers cheers cheers
GENIAL suis trop contente je comprend c est super bien expliqué et comme c est ecris "pour les nuls" mdrrr ca me va encore mieux car soyons realiste je suis nulle dans ce domaine et je compte bien l etre euhhhh un peux moins
donc franchement merci maud j attend la suite avec impatience Bisous

Dernière édition par cmoititi1 le Ven 12 Mar - 12:28, édité 1 fois
Revenir en haut Aller en bas
Voir le profil de l'utilisateur

Messages : 638
Date d'inscription : 21/03/2009

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 12:27

ouais plus sérieusement c cool ...

on comprends mieux là

un ti ex pratique pour voir si j'ai bon :

je croise une gutt classique et une anery :

je sors 1 / 3 d'anery et 3 /4 de classique . donc le gene classique est dominant ?

Revenir en haut Aller en bas
Voir le profil de l'utilisateur

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 12:55

yam a écrit:
ouais plus sérieusement c cool ...

on comprends mieux là

un ti ex pratique pour voir si j'ai bon :

je croise une gutt classique et une anery :

je sors 1 / 3 d'anery et 3 /4 de classique . donc le gene classique est dominant ?


Ah non Yam, c'est pas si simple! Reprends l'exemple de notre bon vieux Gregor avec ses petits pois:

Les pois jaunes sont dominants, ils sont ta gutt classique, les pois verts sont récessifs, ils sont ta gutt anery.

Citation :
Il observa tout d'abord qu'en croisant deux sortes de petits poids, des jaunes et des verts (fallait y penser!) il n'obtenait systématiquement que des jaunes (qui l'eût cru?!).

Donc en croisant ta gutt classique avec ta gutt anery, tu n'obtiens que des gutt classiques, mais ensuite:

Citation :
Et en recroisant ces pois jaunes entre eux, il retrouvait (ça alors!!!) des pois verts! Et à tous les coups, il obtenait en moyenne 1/4 de pois verts pour 3/4 de pois jaunes... étonnant non???

C'est en recroisant les gutt classiques que tu as obtenues entre elles que tu obtiens 1/4 de gutt anery!

C'est plus clair Question
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 13:02

Nous sommes en 1910, les gènes s'appellent des gènes, la génétique s'appelle la génétique, on connait "les lois de Mendel", autant dire que la science de l'époque a à peu près le même niveau en génétique que le forumiste moyen de Café-terra. Ainsi donc, nous sommes tous dans notre élément geek

C'est alors qu'un certain Monsieur Morgan (ça alors, le prénom de mon frère! bon ok, hors sujet, tout le monde s'en tape, et alors?)... Monsieur Morgan donc, décida de s'intéresser à la fascinante intimité de la mouche du vinaigre que vous connaissez tous, amateurs d'amphibiens et de lézards, sous le nom de "Drosophile".

Les années passaient, et on commençait à accumuler pas mal de renseignements sur le sujet. Nous sommes tous des savants en herbe, lorsqu'en 1915, Morgan (pas mon frère, l'autre, celui des mouches) s'aperçut, à force de collectionner les mouches mutantes, que ces fameux gènes qui gouvernent tous les caractères d'un individu se trouvent pécisément sur les chromosomes qu'avait accidentellement découvert l'ami Flemming quelques années plus tôt! Il se trouve que les chromosomes des bébés Drosophiles ont la bonne idée d'être gigantesques, et donc faciles à observer. C'est ainsi qu'avant d'être élevées par nos amis terrariophiles pour nourrir leurs petites espèces insectivores, les Drosophiles devinrent les mouches préférées des généticiens!

En 1928, les savants en herbe que nous sommes suivent de près les progrès de leur science préférée, la récente, mais non moins passionnante génétique!

Découverte cruciale cette année là (cette année là, je chantais pour la premiere fois, le public ne me connaissait pas, quelle année cette annee-là! heum... je vous prie de m'excuser...)

Découverte cruciale donc: l'ADN!!! Bon, ça a l'air moin fun que Cloclo à première vue, mais vous allez voir, c'est totalement fascinant!

En 1928 donc, un certain Griffith s'amusa à infecter des souris avec d'affreux pneumocoques qui les décimèrent toutes (quels babares, ces scientifiques... et on par les terrariophiles après ça Rolling Eyes ceci dit, je note en passant que les savants de l'époque avaient des passe temps très proches des terrario d'aujourd'hui: élevage de Drosophiles, et maintenant élevage de souris... quand je vous dis qu'on est tous des généticiens en puissance!). Bref, revenons à nos souris crevées. Les pneumocoques donc, ces vilains microbes, étaient protégés par une armure, puisqu'ils n'étaient pas décimé par les globules blancs des souris qui éliminaient pourtant facilement d'autres pneumocoques sans armures. (tout le monde maîtrise le sujet des globules blancs qui défendent l'organisme des être vivants contre les vilains microbes? ok on continue...)

Il constata qu'en mélangeant des microbes sans armures avec des cadavres de microbes armés, les globules blancs des souris perdaient la bataille, car des microbes à armures étaient apparus. Il n'en sut pas plus (celui-là ne devait pas avoir le sens de la déduction aussi pointu que notre bon vieux Gregor...)

C'est seulement en 1944 qu'un certain M. Avery révéla, dans un hurlement orgasmique, que le message génétique, c'est de l'ADN!... Il avait découvert que les pneumocoques sans armures avaient récupéré l'ADN des autres pour s'armer à leur tour. Sauf qu'à l'époque, on ne savait pas trop à quoi pouvait bien ressembler le dit ADN.

La suite arrive --->
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com
Café royal
Café royal

Messages : 576
Date d'inscription : 10/01/2010
Age : 34

MessageSujet: re........   Ven 12 Mar - 13:04

Maud, je me coucherai moins con ce soir que ce que je me suis levé ce matin Wink

Merci super intéressant!
Revenir en haut Aller en bas
Voir le profil de l'utilisateur

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 13:16

Peu après la cruciale découverte de l'ADN, on commença a s'apercevoir que certaines de nos maladies sont causées par des gènes déficients (autrement dit faiblards, ratés, imparfaits, incomplets, bref, FOIREUX! Laughing )

Là dessus, un certain Chargaff s'aperçut que l'ADN était fait de quatre sortes de petits machins chmiques appelés bazazoté, ou plutôt "bases azotées". Attention les amis, nous sommes désormais des savants avancés dans la génétique, on va rentrer dans le vif du sujet! Les quatre bases azotées sont l'Adénine, la Guanine, la Cytosine et la Thymine. On ne tarda pas à constater qu'on trouvait toujours autant d'Adéine que de Thymine, et autant de Cytosine que de Guanine dans l'ADN...

Nous sommes en 1953 et, amis généticiens, c'est la course à qui comprendra comment est fichue cette saloperie de molécule d'ADN. Deux ingénieux gugus, un certain Watson, et son jeune ami Crick, construisirent une ingénieuse maquette: c'était l'ADN. A partir de là, on comprit de mieux en mieux ce qu'était le message génétique.

35 ans plus tard, on commence à prendre de la bouteille les copains Glou glou et c'est le début du gigantissime projet LE GENOME HUMAIN. On allait enfin connaitre l'intégralité de nos gènes! Bière Boire net

Et nous voilà en 2000 et des bananes, le "séquençage" de notre génome est presque fini... reste plus qu'à trouver quoi faire avec tout ça

Voila, c'est la fin de ce petit cours d'histoire génétique Wink

Prochain épisode: à la découverte du génome! Nous sommes tous de remarquables généticiens, nous n'avons plus peur de rien, nous voilà armés pour entrer dans le vrai de vrai vif du sujet! (mais là j'ai la dalle et j'ai envie d'un café, alors à tout à l'heure Café caché )
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 13:53

Amis de la génétique, nous revoilà, prêts à partir à la découverte du génome humain, après un bon thé bien chaud et une petite clope salutaire

Pour cela, nous allons plonger au coeur des cellules, dans des endroits microscopiques remplis de molécules de toutes sortes... (vous avez tous regardé "il était une fois la vie" quand vous étiez petits??? ben on va jouer à "il était une fois la vie")

Nimporte quelle cellule fera l'affaire, puisque tout ce qui vit sur Terre possède un génome fait à peu près comme le nôtre (et on en me contredit pas, on a dit "génétique pour les nuls" ok???). C'est bien pratique! Quand vous avez pigé le système pour les z'humains (ou les petits pois) ben ça marche à peu près pareil pour tout le reste

Notre corps, celui d'une vache ou d'une mouche, sont faits de milliards de cellules. Dans chacune d'elles, on trouve plein de trucs très très utiles: des enzymes pour digérer, des protéines pour communiquer, un réveil pour pas être en retard au boulot... oups, nan, pas ça en fait

Mais surtout, il y a le noyau. C'est un gros machin qui peut occuper jusqu'à la moitié de l'espace intérieur, et c'est là qu'on trouvera nos bons vieux chromosomes...

Chaque cellule humaine est dotée de 46 chromosomes, et, chose importante à savoir, chaque chromosome a son jumeau, autrement dit, il y en a 23 paires. Vous allez sans doute vous demander "pourquoi par paires?". C'est on ne peut plus évident, c'est simplement que nous sommes tous ici bas le fruit de la rencontre entre un petit spermatozoïde et un gros ovule. Je ne vous apprends rien en vous disant que le premier vous vient de papa, qui vous a gentiment légué la moitié de son génome dans son minuscule spermatozoïde. Le second vient évidemment de maman, et contenait lui aussi 23 chromosomes: le compte est bon, 46 chromosomes rien qu'à vous! Coeurs

Les chromosomes sont très souvent représentés sous forme de X boudinés dans les ouvrages un peu trop vulgarisés. Cela tient au fait que c'est sous cette forme qu'ils sont le plus faciles à observer au microscope. Il faut toutefois savoir qu'ils n'ont cette forme-là qu'une seule fois dans leur vie, au moment de la division cellulaire appelée mitose (qui n'autorise qu'une multiplication asexuée; elle permet aussi la croissance d'un organe) ou méiose (qui permet la reproduction sexuée). Tout le reste du temps, les chromosomes ont la forme de longs fils très fins en vrac et tout emmêlés dans le noyau.

Enfin, quand je dis en vrac, c'est une image, car en fait, ces longs fils sont savament enrulés autour d'une sorte de collier de perles constitué de protéines autour desquelles s'enroule le fil d'ADN. C'est sur ce fil d'ADN qu'est inscrit notre génome.

A tout de suite pour la suite du cours --->

Dernière édition par Cheyenne le Ven 12 Mar - 14:53, édité 3 fois
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com
American coffee
American coffee

Messages : 471
Date d'inscription : 02/12/2009
Age : 23
Localisation : Saint Priest

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 13:56

Moi je vais attentre de prochain volume "la genetique pour extra nuls" lol!
Revenir en haut Aller en bas
Voir le profil de l'utilisateur

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 13:58

C'est le programme de SVT de 3ème coco, va falloir t'y mettre lol!

En plus je suis gentille, j'ai simplifié autant que possible, je pense pas pouvoir faire mieux study

Et alors les copains, j'vous ai perdu en route Question

En avant camarades, tout le monde sur le front, la suite arrive!
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 14:30

A présent, je suis heureuse de vous annoncer que ceux qui ont tenu jusque là sont des généticiens confirmés, mais surtout, que ça commence à devenir franchement intéressant! (SI SI!!!) sunny

Revenons un peu sur notre copain l'ADN. On n'a même plus peur en lisant ces trois lettre majuscules, on est des pros, des savants, on est cultivés!!! Mais on ne perd pas de vue qu'on en était resté à la maquette des deux gugus qui ont bien compris le fonctionnement de l'ADN, sans pour autant que nous autres novices, si savants soit-on, ayons compris la chose aussi bien qu'eux...

D'abord, j'ai envie de dire, ça veut dire quoi, ça, ADN???

Prenez pas peur les copains, on est des pros, rappellez-vous!!!

ADN veut dire "Acide DésoxyriboNucléique"! AMEN A la tienne camarade! Bière

Maintenant que vous le savez, ça vous fait une belle jambe, mais vous pouvez vous concentrer sur autre chose (ouais ouais, même toi là, arrête de répéter en boucle AcideDésoxyriboNucléiqueAcideDésoxyriboNucléiqueAcideDésoxyriboNucléique... ça t'avance à rien! Range ça dans un coin et n'y penses plus, ça ira mieux tu verras Café )

La seule chose vraiment importante là dedans, c'est de comprendre comment cette molécule d'ADN peut servir au génome.

Bon, pour la forme, je vais vous montrer une représentation en image de la molécule d'ADN que vous avez sans doute déjà tous vu à la télé (Jurassic park, ça vous dit quelque chose?).

Comme vous pouvez le constater, ça ressemble à une échelle souple qui serait entortillée sur elle-même. Chaque montant de notre échelle d'ADN s'appelle "brin".

Les barreaux de notre échelle d'ADN sont nos copines de tout à l'heure, les bases azotées: Adénine (A), Guanine (G), Cytosine (C) et Thymine (T), qui maintiennent les deux brins grâce à leur attirance naturelle.

Si un des brins possède les bases azotées CTTGTGT, l'autre brin aura les bases GAACACA, car les T se lient aux A et les G vont avec les C!

Pour résumer, nous avons dans toutes nos cellules pas loin de 2 mètres d'ADN faits d'une succession de bases azotées du genre ATTCGATCGATCGATCGATCGATCGATCGATCGATCGATGCATCAGTCAGCTA etc...

Vu la taille microscopique, vous vous doutez qu'il y en a un sacré paquet sur une telle longueur. En effet, il y en aurait près de trois milliards de paires!

Et c'est là dedans que se trouvent les gènes...

Hi hi hi!!! Prêts pour la suite??? --->
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 14:59

Bon, je vois que j'ai perdu pas mal d'entre vous en cours de route lol!

Je vais laisser ce post-là en l'état pour vous permettre d'y poser d'éventuelles questions, et je poursuivrai dans un autre post pour la suite Wink

Je vous encourage à vous accrocher, c'est vraiment intéressant de comprendre, et vous pourrez ensuite transposer ces connaissances à vos petites bestioles Very Happy
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com
Café royal
Café royal

Messages : 2755
Date d'inscription : 19/03/2009
Age : 42
Localisation : meyzieu banlieu lyon

MessageSujet: .   Ven 12 Mar - 15:34

ouai ta raison maud moi la j ai levé le pied lol! laisse nous le week end pour bien nous replonger dedans et tout bien decortiquer afin qu on puisse comme tu dit te poser des questions Wink
en tout cas
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
American coffee
American coffee

Messages : 471
Date d'inscription : 02/12/2009
Age : 23
Localisation : Saint Priest

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 15:48

A ba oui voila que sa me revien se cour de svt en 3eme deja sa devien un peu plus clair pour moi
Meme si des fois je me gratte uun peu la tete scratch mais jai compris tout le principal

Merciiii pour ce jolie cours de svt
Revenir en haut Aller en bas
Voir le profil de l'utilisateur

Messages : 2482
Date d'inscription : 18/03/2009
Age : 37
Localisation : 69

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Ven 12 Mar - 17:10

Prenez le week-end, t'façon chui pô là jusqu'à dimanche matin, méditez là dessus, posez vos question, et lundi on rattaque! Wink
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://cafeterra.forumactif.com
American coffee
American coffee

Messages : 211
Date d'inscription : 03/11/2009
Age : 25
Localisation : 28

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Lun 29 Mar - 2:40

Allez, maintenant on es lundi XD Avec trois semaines de retard (ui ui, j'ai un sacré décallage horaire, ça se voit Laughing )

Je veux pas que tu abandonnes, t'es une super prof!!!
Et jusque là jte suis complètement!!! J'ai tout compris!!! cheers

(promis, je dis pas que j'avais déjà bouffé pas mal de cours là dessus avant, mais j'attends avec impatience le tome II de ce best-seller qu'est "La génétique pour les nuls", par tata Cheyenne )

Ce qu'on ne nous dit pas, c'est que Mendel était daltonien : c'est bien lui qui a dit "les petits pois sont rouges"
(Si vous me cherchez, jsuis au bout de la corde)
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
American coffee
American coffee

Messages : 211
Date d'inscription : 03/11/2009
Age : 25
Localisation : 28

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Jeu 8 Avr - 16:29

Bon, j'ai achetté ton super livre, mais je voudrais bien la suite!!!

A quand le deuxième tome?! xD
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
American coffee
American coffee

Messages : 471
Date d'inscription : 02/12/2009
Age : 23
Localisation : Saint Priest

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Jeu 8 Avr - 16:42

lol! lol!

Mdrrrr jolie bouquin je le veut!!!
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
American coffee
American coffee

Messages : 332
Date d'inscription : 19/08/2009
Age : 48
Localisation : somme (80)

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   Jeu 8 Avr - 18:31

Cheyenne nous a caché ses talents d'écrivain Suspect Laughing
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Contenu sponsorisé

MessageSujet: Re: La génétique "pour les nuls" 1ère partie   

Revenir en haut Aller en bas
La génétique "pour les nuls" 1ère partie
Revenir en haut 
Page 1 sur 1

Permission de ce forum:Vous ne pouvez pas répondre aux sujets dans ce forum
Café-terra :: Terrariophilie :: Génétique-
Sauter vers: